Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human WDR11 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX16
Species: Human
Target Gene: WDR11
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human WDR11 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0525XX16-1 ACGTGTTCGAAGATCTTATAA CDS Inquiry
V0525XX16-2 GCAGTCGTATTCAGAGATAAA CDS Inquiry
V0525XX16-3 GAACGTGAATGCTTAAGATTT 3' UTR Inquiry
V0525XX16-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human WDR11 shRNA Ad5 Adenoviral Particle (Silencing) focuses on the genetic inhibition of WDR11, a scaffolding protein linked to congenital hypogonadotropic hypogonadism and central obesity via its role in GnRH neuron development and hedgehog signaling pathways. By deploying either U6 or specialized miR30-based shRNA architectures within an Ad5 viral carrier, this tool enables the mapping of neuroendocrine-driven metabolic imbalances. The product allows for flexible reporter gene selections to visualize transduction efficiency, while being backed by an exhaustive quality control framework that spans functional titration, sterility verification, and mycoplasma testing to secure precise and reliable in vitro or in vivo data.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: WDR11
Full Name: WD repeat domain 11
Gene Symbol: DR11; HH14; SRI1; BRWD2; WDR15
Gene ID: 55717
RefSeq ID-1: NP_060587.8
RefSeq ID-2: NM_018117.11
Summary: WDR11 encodes a WD-repeat scaffold protein that participates in the assembly of multiprotein complexes involved in signal transduction, cell-cycle control, apoptosis, and transcriptional regulation. The gene maps to chromosome 10q25–26, a region frequently deleted in gliomas and other tumors, and is disrupted by the t(10;19) rearrangement observed in glioblastoma cells. These genomic observations have led to its consideration as a candidate tumor-suppressor locus.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.