Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human BDNF shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX21
Species: Human
Target Gene: BDNF
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human BDNF shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX21-1 GTATGTACATTGACCATTAAA CDS Inquiry
V0126XX21-2 TTTCCTTACTATGGTTATTTC CDS Inquiry
V0126XX21-3 ACAGTGGTTCTACAATCTATT 3' UTR Inquiry
V0126XX21-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human BDNF shRNA Ad5 Particle (Silencing) is a premier tool for suppressing BDNF, a key regulator of synaptic plasticity and energy intake. This precise gene-knockdown system facilitates the exploration of how BDNF levels influence weight gain and glucose metabolism. Every batch undergoes rigorous internal QC, including functional titer and sequence verification, ensuring safety and reproducibility across various experimental models.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: BDNF
Full Name: Brain derived neurotrophic factor
Gene Symbol: ANON2; BULN2
Gene ID: 627
RefSeq ID-1: NP_001137277.1
RefSeq ID-2: NM_001143805.1
Summary: BDNF encodes a neurotrophic factor belonging to the nerve growth factor protein family. Through alternative splicing, the gene produces multiple transcript variants, some of which are translated into precursor proteins that are subsequently cleaved to generate the biologically active form. The mature BDNF protein supports neuronal survival and function in the adult brain via interaction with its specific receptor. Reduced expression of BDNF has been observed in several neurodegenerative disorders, including Alzheimer’s, Parkinson’s, and Huntington’s diseases. In addition, BDNF is implicated in stress regulation and has been linked to mood-related disorders, suggesting broader roles in central nervous system function and energy balance.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.