Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human NHLH2 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX164
Species:
Human
Target Gene:
NHLH2
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX164-1 | CAGAGTATGCAGGCTCATAAC | 3' UTR | Inquiry |
| V0126XX164-2 | CGTGTGATGAATTTAGCAAAT | 3' UTR | Inquiry |
| V0126XX164-3 | ACTTTGAGTTCTCCTACATTC | 3' UTR | Inquiry |
| V0126XX164-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human NHLH2 shRNA Ad5 Particle (Silencing) enables the targeted inhibition of the NHLH2 transcription factor, which is required for the expression of genes involved in energy expenditure and physical activity. By silencing NHLH2 via our optimized shRNA platforms, researchers can model the pathways leading to adult-onset obesity and reduced exercise drive. Each batch is subjected to comprehensive QC screening—including functional titer and sterility checks—to safeguard your research outcomes.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
NHLH2
Full Name:
Nescient helix-loop-helix 2
Gene Symbol:
HEN2; HH27; NSCL2; bHLHa34
Gene ID:
4808
RefSeq ID-1:
NP_001104531.1
RefSeq ID-2:
NM_001111061.2
Summary:
NHLH2 is a transcription factor required for the development of neurons in the hypothalamus that control energy balance and reproduction. It is directly implicated in the obesity-hypogonadism axis. A lack of NHLH2 leads to a significant decrease in metabolic rate and an increase in food intake, as the brain loses its ability to process energy-status signals correctly.
Related Products
-
AdipoUpX™ Human IL33 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human CEBPA shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human TCF7L2 shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human ACLY Ad5 Particle (Overexpression)
-
AdipoUpX™ Human INSR Ad5 Particle (Overexpression)
-
AdipoUpX™ Human CD36 Ad5 Particle (Overexpression)