LipoKnoxa™ Human SIRT4 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX47

Species: Human

Target Gene: SIRT4

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human SIRT4 shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0525XX47-1	GAACCCTGACAAGGTTGATTT	CDS	Inquiry
V0525XX47-2	GCTGACCACAGCCTGATATTC	CDS	Inquiry
V0525XX47-3	ACAGGGACTTTCACTTGAATC	3' UTR	Inquiry
V0525XX47-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human SIRT4 shRNA Ad5 Adenoviral Particle (Silencing) is specifically developed to interrupt the expression of Sirtuin 4, a mitochondrial NAD+-dependent ADP-ribosyltransferase that negatively regulates fatty acid oxidation and amino acid-stimulated insulin secretion. By silencing SIRT4, researchers can activate the AMPK/ACC pathway, thereby stimulating fatty acid breakdown and offering a unique therapeutic model for overcoming obesity-induced hepatic lipid accumulation. To achieve precise knockdown, our platform utilizes premium Ad5 delivery of either short-hairpin U6 or native-like miR30-based shRNA systems. Each specific batch undergoes meticulous, comprehensive quality control testing—including functional titer profiling, sterility verification, and mycoplasma assessment—to ensure flawless biosafety and strict data reproducibility in mitochondrial research.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: SIRT4

Full Name: Sirtuin 4

Gene Symbol: SIR2L4

Gene ID: 23409

RefSeq ID-1: NP_001372662.1

RefSeq ID-2: NM_001385733.2

Summary: SIRT4 encodes a mitochondrial member of the sirtuin protein family, which is evolutionarily related to the yeast Sir2 proteins. Sirtuins are characterized by a conserved catalytic core and are involved in cellular regulatory processes linked to metabolism and stress adaptation. SIRT4 belongs to the class IV subgroup and has been reported to possess mono-ADP-ribosyltransferase activity. Its mitochondrial localization suggests an important role in coordinating metabolic pathways and energy balance.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out