Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human TMEM18 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX100
Species:
Human
Target Gene:
TMEM18
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX100-1 | TGCGATGAACTGGAGATTATT | CDS | Inquiry |
| V0126XX100-2 | GAGCTTCATAACTGGGAATTT | 3' UTR | Inquiry |
| V0126XX100-3 | GCTGCGATGAACTGGAGATTA | CDS | Inquiry |
| V0126XX100-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human TMEM18 shRNA Ad5 Particle (Silencing) targets a transmembrane protein identified through GWAS as a strong risk factor for childhood and adult obesity. Silencing TMEM18 assists in uncovering the neuronal pathways involved in weight gain. We provide a fully validated product through comprehensive quality control, ensuring sequence integrity, functional titer, and sterility for consistent performance in metabolic genomic research.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
TMEM18
Full Name:
Transmembrane protein 18
Gene Symbol:
lncND
Gene ID:
129787
RefSeq ID-1:
NP_001339609.1
RefSeq ID-2:
NM_001352680.2
Summary:
TMEM18 encodes a small protein located in the nuclear membrane that is thought to bind DNA and influence cell migration. Despite its relatively simple structure, TMEM18 is consistently identified in genome-wide association studies (GWAS) as one of the strongest genetic loci for obesity and Body Mass Index (BMI). While its exact molecular mechanism in weight gain is still being characterized, it is believed to function within the hypothalamic centers that regulate long-term energy balance.
Related Products
-
LipoKnoxa™ Human PNLIP shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human SIRT6 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human IGF1 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human TMEM18 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human FBN1 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human PLIN2 shRNA Ad5 Particle (Silencing)