Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human PAQR4 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX164
Species: Human
Target Gene: PAQR4
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human PAQR4 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0525XX164-1 CCGTGCTCTATCACCTCTTTA CDS Inquiry
V0525XX164-2 ACAGCAGCCTCCTAGAGTTAG 3' UTR Inquiry
V0525XX164-3 GCACCTGCAGTTCAATAAGTT CDS Inquiry
V0525XX164-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human PAQR4 shRNA Ad5 Adenoviral Particle (Silencing) targets the PAQR4 gene, a member of the progestin and adipoQ receptor family that modulates cell proliferation, apoptotic pathways, and ceramide-like lipid rheostat kinetics. Knockdown of PAQR4 disrupts downstream insulin signaling cascades and alters regular fat deposition in adipocytes, serving as an attractive loss-of-function model for studying lipotoxicity-induced insulin resistance. Facilitated by either high-potency U6 or strategically designed miR30-based shRNA platforms, this recombinant virus achieves high-efficiency transduction in primary pre-adipocytes. Every single production lot is fully certified by extensive quality control protocols, confirming ideal functional titer, absolute sterility, and a mycoplasma-free status to safeguard your downstream outcomes.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: PAQR4
Full Name: Progestin and adipoQ receptor family member 4
Gene ID: 124222
RefSeq ID-1: NP_001271440.1
RefSeq ID-2: NM_001284511.2
Summary: PAQR4 acts as a molecular adaptor protein involved in protein stabilization and regulation of ceramide biosynthesis. It is localized to the Golgi membrane and participates in lipid metabolic processes that influence cellular lipid balance.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.