LipoKnoxa™ Human MZB1 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX89

Species: Human

Target Gene: MZB1

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human MZB1 shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0525XX89-1	GGCAGAGACCAAACTTCATAC	CDS	Inquiry
V0525XX89-2	CTCTACCCTCCTCTGAAAGAA	3' UTR	Inquiry
V0525XX89-3	GAGCTGTGGCTTACCAGATGT	CDS	Inquiry
V0525XX89-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human MZB1 shRNA Ad5 Adenoviral Particle (Silencing) is fine-tuned to suppress MZB1, an ER-localized chaperone protein increasingly recognized as an essential player in plasma cell differentiation and the inflammatory remodeling of white adipose tissue in obese individuals. Silencing MZB1 allows scientists to explore the fine balance between B-cell-driven chronic low-grade inflammation and downstream insulin desensitization in peripheral tissues. Accommodating both high-potency U6 promoters and native-mimetic miR30-based systems within an Ad5 viral carrier, this high-efficiency virus ensures optimal knockdown dynamics. Each product batch is subjected to stringently monitored quality assurance tests, validating functional titer, sterility, and mycoplasma parameters to deliver supreme safety and reproducibility for metabolic axis studies.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: MZB1

Full Name: Marginal zone B and B1 cell specific protein

Gene Symbol: PACAP; pERp1; MEDA-7

Gene ID: 51237

RefSeq ID-1: NP_057543.2

RefSeq ID-2: NM_016459.4

Summary: MZB1 encodes a protein involved in cellular proliferation and immune-related secretory processes. It is localized in both the cytoplasm and the extracellular space. MZB1 has been implicated in the regulation of antibody secretion and B-cell function. Its precise molecular mechanisms remain under investigation, but it is associated with immune cell activity.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out