Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human GNB3 shRNA Ad5 Particle (Silencing)

Cat. No.: V0525XX191
Species: Human
Target Gene: GNB3
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human GNB3 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0525XX191-1 GCTTCCTGGATGACAACAATA CDS Inquiry
V0525XX191-2 CCTGACTTCAATCTCTTCATT CDS Inquiry
V0525XX191-3 TGTTCCATCTACAACCTCAAA CDS Inquiry
V0525XX191-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human GNB3 shRNA Ad5 Adenoviral Particle (Silencing) provides selective knockdown of GNB3, a core G protein beta subunit whose genetic splice variants are strongly associated with increased intracellular signal transduction, systemic vasoconstriction, and a strong predisposition to metabolic syndrome and visceral obesity. Suppressing GNB3 expression allows metabolic researchers to explore the fine balance between beta-adrenergic-stimulated lipolysis and downstream second-messenger signaling alterations under calorie excess conditions. Developed utilizing either standard U6 or specialized miR30-based shRNA expression architectures, this high-titer Ad5 vehicle ensures sweeping transduction. Backed by rigorous comprehensive quality control screening—including rigorous functional titer, sterility, and mycoplasma testing—this product ensures outstanding safety and experimental reproducibility.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: GNB3
Full Name: G protein subunit beta 3
Gene Symbol: HG2D; CSNB1H
Gene ID: 2784
RefSeq ID-1: NP_001284500.1
RefSeq ID-2: NM_001297571.1
Summary: GNB3 encodes the β3 subunit of heterotrimeric G proteins, which regulate signal transduction from membrane receptors. A common polymorphism (C825T) has been associated with obesity and hypertension, partly through altered G protein signaling activity and splice variant formation.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.