Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human FFAR4 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX90
Species: Human
Target Gene: FFAR4
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human FFAR4 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX90-1 TGGGTGGTGGCCTTCACATTT CDS Inquiry
V0126XX90-2 CTGGTCATTGTGATCAGTTAC CDS Inquiry
V0126XX90-3 CGACCAGGAAATTTCGATTTG CDS Inquiry
V0126XX90-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human FFAR4 shRNA Ad5 Particle (Silencing) targets the FFAR4, a receptor for long-chain omega-3 fatty acids that mediates anti-inflammatory effects and insulin sensitization. By silencing FFAR4 using optimized shRNA, researchers can model the loss of protective lipid signaling in obesity. Each viral preparation is subjected to total QC verification—covering sequence identity and functional activity—to ensure that your experimental results are both safe and scientifically sound.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: FFAR4
Full Name: Free fatty acid receptor 4
Gene Symbol: GT01; PGR4; OB10Q; BMIQ10; GPR120; GPR129; O3FAR1
Gene ID: 338557
RefSeq ID-1: NP_001182684.1
RefSeq ID-2: NM_001195755.2
Summary: FFAR4 encodes a G protein-coupled receptor that acts as a sensor for long-chain omega-3 fatty acids. Once activated, it triggers potent anti-inflammatory effects and improves insulin sensitivity, particularly in adipose tissue. By suppressing chronic low-grade inflammation, FFAR4 serves as a protective metabolic factor. Its ability to sense healthy fats makes it a major therapeutic target for treating the inflammatory and metabolic complications associated with obesity.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.