Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human UCP3 shRNA Lentiviral Particle (Silencing)
Cat. No.:
V0126XX427
Species:
Human
Target Gene:
UCP3
Vector System:
Lentiviral
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX427-1 | CCGTGAAATCTGGTTAGATAA | 3' UTR | Inquiry |
| V0126XX427-2 | CGTGGTGAAGACCCGGTATAT | CDS | Inquiry |
| V0126XX427-3 | TGATGAAAGTCCAGATGTTAC | CDS | Inquiry |
| V0126XX427-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human UCP3 shRNA Lentiviral Particle (Silencing) is a precision tool for knocking down UCP3, primarily involved in skeletal muscle thermogenesis and fatty acid metabolism. Our lentiviral system supports both U6-driven and miR30-based shRNA strategies, offering researchers the choice between maximum potency and physiologically refined silencing. To ensure experimental success, all particles undergo rigorous quality control for titer, sterility, and the absence of mycoplasma.
Production Cell Line:
HEK293T
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test:
Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test:
Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC:
Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage:
Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability:
Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition:
Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes:
Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.
Target Profile
Gene Name:
UCP3
Full Name:
Uncoupling protein 3
Gene Symbol:
SLC25A9
Gene ID:
7352
RefSeq ID-1:
NP_003347.1
RefSeq ID-2:
NM_003356.4
Summary:
UCP3 encodes a key mitochondrial inner membrane protein that operates as a proton leak channel. This protein's primary function is to uncouple oxidative phosphorylation from ATP synthesis, allowing the potential energy stored in the proton gradient to be dissipated directly as heat. While mainly expressed in skeletal muscle, UCP3 also acts as a mitochondrial safety valve: when fatty acid supply exceeds oxidation capacity, it facilitates the export of fatty acids, shielding mitochondria from lipid-induced oxidative stress. This process is vital for overall energy expenditure and metabolic flexibility.