LipoKnoxa™ Human BBS5 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX477-1	TATCTGCAAATTCGTTCAATA	CDS	Inquiry
V0126XX477-2	CAAGATCGTGAACCTGTATTT	CDS	Inquiry
V0126XX477-3	CCCATATTTGGAGTTGATTAT	CDS	Inquiry
V0126XX477-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human BBS5 shRNA Lentiviral Particle (Silencing) targets a core component of the BBSome essential for ciliary membrane organization. Utilizing our dual-strategy shRNA platform (U6 and miR30), researchers can investigate the mechanisms of ciliary transport in metabolic disease. Every product is backed by comprehensive QC documentation, confirming sequence integrity and the total absence of pathogens, ensuring high functional titers for ex vivo studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: BBS5

Full Name: Bardet-Biedl syndrome 5

Gene ID: 129880

RefSeq ID-1: NP_689597.1

RefSeq ID-2: NM_152384.3

Summary: BBS5 is directly associated with Bardet-Biedl syndrome (BBS), a severe autosomal recessive ciliopathy. The BBS5 protein is a crucial component of the BBSome complex and is required for the proper structure and function of the primary cilium. Experimental data confirm that BBS5 is expressed in ciliated cells and is necessary for ciliary formation. Mutations in BBS5 result in the BBS phenotype, whose primary features include retinal dystrophy, polydactyly, renal abnormalities, learning disabilities, and severe, early-onset obesity, underscoring the link between ciliary transport and metabolic control.

LipoKnoxa™ Human BBS5 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products