LipoKnoxa™ Human PIK3CA shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX496-1	GCGAAATTCTCACACTATTAT	CDS	Inquiry
V0126XX496-2	GCTTGAAGAGTGTCGAATTAT	CDS	Inquiry
V0126XX496-3	GATTCCACACTGCACTGTTAA	3' UTR	Inquiry
V0126XX496-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PIK3CA shRNA Lentiviral Particle (Silencing) targets PIK3CA, a central node in the insulin signaling cascade. By utilizing either high-potency U6-driven shRNA or physiologically optimized miR30 architectures, researchers can study lipid synthesis and glucose uptake in stable cell lines. Every batch is validated through stringent QC processes, including functional titering and microbial contaminants screening, providing a secure foundation for signaling research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PIK3CA

Full Name: Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha

Gene Symbol: HMH; MCM; CCM4; CWS5; MCAP; PI3K; CLAPO; CLOVE; MCMTC; PI3K-alpha; p110-alpha

Gene ID: 5290

RefSeq ID-1: NP_006209.2

RefSeq ID-2: NM_006218.4

Summary: PIK3CA encodes the catalytic subunit of phosphatidylinositol 3-kinase (PI3K), which phosphorylates phosphoinositides to control intracellular signaling. While frequently associated with cancer, PI3K activity also regulates insulin signaling and energy metabolism, suggesting a potential influence on adiposity. A pseudogene exists on chromosome 22.

LipoKnoxa™ Human PIK3CA shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products