LipoKnoxa™ Human IL13 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX615

Species: Human

Target Gene: IL13

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human IL13 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX615-1	ACTTCGAAAGCATCATTATTT	3' UTR	Inquiry
V0126XX615-2	ATTGAAGTTGCAGATTCATTT	3' UTR	Inquiry
V0126XX615-3	CCTGCTCTTACATTTAAAGAA	CDS	Inquiry
V0126XX615-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human IL13 shRNA Lentiviral Particle (Silencing) targets interleukin-13, a cytokine modulating alternative macrophage activation and hepatic insulin sensitivity. Silencing IL13 via high-efficiency U6 or miR30 shRNA delivery allows for the investigation of immune-mediated metabolic regulation. To ensure the highest level of biosafety, all products undergo total quality control screening for functional titer and microbial safety, providing a secure tool for long-term immunological research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: IL13

Full Name: Interleukin 13

Gene Symbol: P600; IL-13

Gene ID: 3596

RefSeq ID-1: NP_002179.2

RefSeq ID-2: NM_002188.2

Summary: IL13 encodes an immunoregulatory cytokine predominantly produced by activated Th2 cells. It plays multiple roles in B-cell maturation and differentiation, promotes IgE class switching, upregulates CD23 and MHC class II expression, and suppresses macrophage-derived pro-inflammatory cytokines and chemokines. IL13 is critical in allergen-induced asthma and functions independently of IgE and eosinophils. In the context of obesity, IL13 contributes to immune–metabolic crosstalk by modulating adipose tissue inflammation, which is a key driver of insulin resistance and metabolic dysfunction. IL13 is part of a cytokine gene cluster on chromosome 5q, located near IL4.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out