LipoKnoxa™ Human PRKACA shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX567-1	CAACCTTCCTTTCGGAGTAAT	3' UTR	Inquiry
V0126XX567-2	CAAGGACAACTCAAACTTATA	CDS	Inquiry
V0126XX567-3	CCAGAGTTCCTTGCATCTAAT	3' UTR	Inquiry
V0126XX567-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PRKACA shRNA Lentiviral Particle (Silencing) targets the alpha catalytic subunit of PKA, central to lipolysis regulation. By utilizing high-potency U6-driven shRNA or physiologically refined miR30 architectures, researchers can study cAMP-dependent metabolic control. Every batch is subjected to rigorous QC verification—covering functional titer, sequence accuracy, and sterility.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PRKACA

Full Name: Protein kinase cAMP-activated catalytic subunit alpha

Gene Symbol: CAFD1; PKACA; PPNAD4

Gene ID: 5566

RefSeq ID-1: NP_001291278.1

RefSeq ID-2: NM_001304349.1

Summary: PRKACA encodes the alpha catalytic subunit of protein kinase A (PKA), which is activated by cAMP. This kinase phosphorylates a wide array of targets involved in lipolysis and glucose production. Constitutive activation of PRKACA, often through gene duplication or mutation, causes corticotropin-independent Cushing’s syndrome and adrenal hyperplasias.

LipoKnoxa™ Human PRKACA shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products