Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human PHIP shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX438
Species: Human
Target Gene: PHIP
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human PHIP shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX438-1 CACTCTTTAGGAGCATAATAT 3' UTR Inquiry
V0126XX438-2 AGCACGTATTTGGCAATTTAA CDS Inquiry
V0126XX438-3 ATGGAGCTTATACCTAATAAT CDS Inquiry
V0126XX438-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human PHIP shRNA Lentiviral Particle (Silencing) focuses on the targeted inhibition of the PHIP gene, essential for insulin receptor signaling and neuronal health. Engineered via an advanced RNAi platform with both U6 and miR30 systems, this lentiviral tool facilitates the investigation of cognitive and metabolic defects. To guarantee experimental reliability, every preparation undergoes total QC verification—covering functional titer, sequence identity, and mycoplasma testing.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PHIP
Full Name: PHIP subunit of CUL4-Ring ligase complex
Gene Symbol: ndrp; BRWD2; DIDOD; RepID; WDR11; DCAF14; CHUJANS
Gene ID: 55023
RefSeq ID-1: NP_060404.4
RefSeq ID-2: NM_017934.6
Summary: PHIP encodes a protein primarily recognized for its ability to bind to Insulin Receptor Substrate 1 (IRS1), thereby playing a role in regulating the translocation of glucose transporters within skeletal muscle cells. This protein may also contribute to the growth and survival of pancreatic beta cells. Beyond metabolism, PHIP has oncogenic relevance: elevated gene copy number is linked to increased melanoma severity, and the protein itself is postulated to promote melanoma metastasis in patients.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.