Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human IL33 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX598
Species: Human
Target Gene: IL33
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human IL33 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX598-1 GAGTGCTTTGCCTTTGGTATA CDS Inquiry
V0126XX598-2 GCACTCCAACTGTGTTTCATT CDS Inquiry
V0126XX598-3 CCTGTTACTTTAGGAGAGAAA CDS Inquiry
V0126XX598-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human IL33 shRNA Lentiviral Particle (Silencing) facilitates the robust silencing of interleukin-33, an alarmin cytokine that regulates adipose tissue-resident immune cells. Our platform provides flexibility through the development of both U6 and miR30-based shRNA systems to study thermogenesis and metabolic inflammation. Each batch is subjected to total quality control validation, including functional titer, sterility, and mycoplasma testing, ensuring repeatable and safe results for long-term cell culture experiments.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: IL33
Full Name: Interleukin 33
Gene Symbol: DVS27; IL1F11; NF-HEV; NFEHEV; C9orf26
Gene ID: 90865
RefSeq ID-1: NP_001186569.1
RefSeq ID-2: NM_001199640.2
Summary: IL33 is a multi-functional cytokine that signals through the ST2 receptor to activate protective immune responses. In metabolic tissues, IL33 is vital for the maturation of Th2 cells and the maintenance of a "healthy" immune environment within fat. It helps balance the aggressive inflammation caused by overnutrition, playing a role in the preservation of insulin sensitivity.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.