LipoKnoxa™ Human KIDINS220 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX457

Species: Human

Target Gene: KIDINS220

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human KIDINS220 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX457-1	GAGGTGAGATCTGAGTATAAA	3' UTR	Inquiry
V0126XX457-2	GGCCTGCAAGATCCAATTATA	CDS	Inquiry
V0126XX457-3	CCGGACTTCATGGCTCATATT	CDS	Inquiry
V0126XX457-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human KIDINS220 shRNA Lentiviral Particle (Silencing) is designed for the stable inhibition of KIDINS220, a crucial mediator of neurotrophin signaling and metabolic health. To meet diverse experimental demands, we offer both high-potency U6-driven and physiologically refined miR30-based shRNA frameworks. Each viral preparation is subjected to total QC verification—covering sequence identity and functional activity—ensuring reproducible results in neuronal or endocrine cell models.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: KIDINS220

Full Name: Kinase D interacting substrate 220

Gene Symbol: ARMS; SINO; VENARG

Gene ID: 57498

RefSeq ID-1: NP_001335661.1

RefSeq ID-2: NM_001348732.2

Summary: KIDINS220 encodes a transmembrane protein predominantly expressed in the nervous system, where it regulates neuronal survival, dendritic differentiation, and synaptic plasticity. The protein serves as a scaffold linking membrane receptors, cytosolic signaling components, and cytoskeletal proteins, facilitating crosstalk between neurotrophin and other intracellular signaling pathways. Mutations or aberrant expression are associated with neuropsychiatric disorders, neurodegenerative diseases, and a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus, and obesity. Alternative splicing results in multiple transcript variants.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out