LipoKnoxa™ Human BBS4 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX468-1	GCACGATCTGACTTATATAAT	CDS	Inquiry
V0126XX468-2	ACCTAGGAGTTTGCTACATAT	CDS	Inquiry
V0126XX468-3	TGACCAATCTGGAAGATATAG	CDS	Inquiry
V0126XX468-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human BBS4 shRNA Lentiviral Particle (Silencing) is designed to suppress BBS4, a protein linking the BBSome to dynein-mediated transport. Utilizing a choice between high-potency U6 systems and physiologically optimized miR30-based shRNA, researchers can investigate ciliary-dependent signaling pathways. To ensure the highest level of biosafety, all products undergo total quality control screening, ensuring high functional titers and the absence of microbial contaminants.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: BBS4

Full Name: Bardet-Biedl syndrome 4

Gene ID: 585

RefSeq ID-1: NP_001239607.1

RefSeq ID-2: NM_001252678.2

Summary: BBS4 is a BBS gene family member involved in Bardet-Biedl syndrome, characterized by obesity, retinal dystrophy, polydactyly, renal anomalies, and cognitive deficits. BBS4 contributes to cilia formation and function, localizing to basal bodies, ciliary axonemes, and pericentriolar regions, and participates in microtubule-dependent intracellular trafficking. It also interacts with O-linked N-acetylglucosamine (O-GlcNAc) transferases to form the multi-protein BBSome complex. Multiple transcript variants are generated through alternative splicing.

LipoKnoxa™ Human BBS4 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products