Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human ARL6 shRNA Lentiviral Particle (Silencing)
Cat. No.:
V0126XX486
Species:
Human
Target Gene:
ARL6
Vector System:
Lentiviral
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX486-1 | TTTCAATTCAAGGAATCTATC | 3' UTR | Inquiry |
| V0126XX486-2 | CATTTGATTGTACGTAGAATG | 3' UTR | Inquiry |
| V0126XX486-3 | CGACGATCATTAACAAACTTA | CDS | Inquiry |
| V0126XX486-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human ARL6 shRNA Lentiviral Particle (Silencing) targets the small GTPase BBS3, which is necessary for the ciliary entry of the BBSome. Engineered with both high-potency U6 and physiologically refined miR30-based shRNA, this tool helps researchers study ciliary membrane trafficking. Supported by total quality control screening for functional titer and sterility, these particles guarantee stable integration and reliable knockdown for long-term study.
Production Cell Line:
HEK293T
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test:
Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test:
Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC:
Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage:
Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability:
Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition:
Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes:
Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.
Target Profile
Gene Name:
ARL6
Full Name:
ARF like GTPase 6
Gene Symbol:
BBS3; RP55
Gene ID:
84100
RefSeq ID-1:
NP_001265222.1
RefSeq ID-2:
NM_001278293.3
Summary:
ARL6 encodes a small GTP-binding protein of the ARF-like family, which is involved in regulating intracellular trafficking and ciliary transport. It facilitates the movement of BBSome components and is critical for cilia function. Mutations in ARL6 cause Bardet–Biedl syndrome, which often presents with obesity, retinal degeneration, and kidney abnormalities. A vision-specific transcript, BBS3L, encodes a longer isoform relevant to retinal function.