LipoKnoxa™ Human MTCH2 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX576-1	AGCCGAGGAAATAGCTTATTT	CDS	Inquiry
V0126XX576-2	CCAGAATCTGACTCCCATTAT	3' UTR	Inquiry
V0126XX576-3	CCTCCAACAATAGGACGAAAT	CDS	Inquiry
V0126XX576-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human MTCH2 shRNA Lentiviral Particle (Silencing) focuses on the inhibition of MTCH2, a gene strongly associated with body mass index (BMI) and mitochondrial nutrient sensing. To meet diverse experimental requirements, our lentiviral system includes both high-potency U6-driven shRNA for maximum silencing or miR30-based shRNA for reduced cellular toxicity. This tool facilitates the study of mitochondrial recruitment and lipid metabolism in obesity. Rigorous quality control, covering sequence integrity, sterility, and functional titering, ensures that these particles meet the highest standards of biosafety for consistent long-term research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: MTCH2

Full Name: Mitochondrial carrier 2

Gene Symbol: MIMP; HSPC032; SLC25A50

Gene ID: 23788

RefSeq ID-1: NP_001304160.1

RefSeq ID-2: NM_001317231.1

Summary: MTCH2 encodes a mitochondrial inner membrane transporter involved in energy metabolism and adipocyte differentiation. GWAS studies link MTCH2 polymorphisms to obesity, highlighting its role in regulating lipid storage and adipose tissue function. Alternative splicing generates isoforms with potentially distinct metabolic effects.

LipoKnoxa™ Human MTCH2 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products