LipoKnoxa™ Human IFT172 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX534-1	CCAGTGGAAGAAGGCAATTTA	CDS	Inquiry
V0126XX534-2	GCAGACAATTGCTCCTTTGAA	CDS	Inquiry
V0126XX534-3	GAACATGGAGAACGGAGAGAT	CDS	Inquiry
V0126XX534-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human IFT172 shRNA Lentiviral Particle (Silencing) targets a component of the intraflagellar transport complex essential for ciliary maintenance. Engineered via our dual-strategy platform (U6 and miR30 systems), this tool allows for stable modeling of ciliopathy-related obesity. Each preparation is backed by exhaustive QC documentation, confirming functional titer, sterility, and sequence integrity.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: IFT172

Full Name: Intraflagellar transport 172

Gene Symbol: SLB; wim; RP71; BBS20; osm-1; NPHP17; SRTD10

Gene ID: 26160

RefSeq ID-1: NP_056477.1

RefSeq ID-2: NM_015662.3

Summary: IFT172 encodes a structural component of the intraflagellar transport B complex, which is essential for primary cilium formation and maintenance. Primary cilia serve as signaling hubs for pathways involved in energy balance and development. Disruption of IFT172 function is linked to ciliopathies that frequently present with metabolic abnormalities, including obesity.

LipoKnoxa™ Human IFT172 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products