LipoKnoxa™ Human TNF shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX459

Species: Human

Target Gene: TNF

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human TNF shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX459-1	GGAGCCAGCTCCCTCTATTTA	3' UTR	Inquiry
V0126XX459-2	TGGCGTGGAGCTGAGAGATAA	CDS	Inquiry
V0126XX459-3	GAACCCAAGCTTAGAACTTTA	3' UTR	Inquiry
V0126XX459-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human TNF shRNA Lentiviral Particle (Silencing) is engineered to suppress TNF, the primary pro-inflammatory cytokine driving insulin resistance. Our lentiviral system supports both U6 and miR30-based shRNA strategies, allowing for the stable dissection of chronic inflammation pathways. To ensure experimental success, all particles undergo comprehensive quality control, covering functional titer, sequence integrity, and mycoplasma testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: TNF

Full Name: Tumor necrosis factor

Gene Symbol: DIF; TNFA; IMD127; TNFSF2; TNLG1F; TNF-alpha

Gene ID: 7124

RefSeq ID-1: NP_000585.2

RefSeq ID-2: NM_000594.3

Summary: TNF encodes a multifunctional proinflammatory cytokine belonging to the tumor necrosis factor superfamily. Primarily secreted by macrophages, it signals through TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. TNF regulates cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. Dysregulation is implicated in autoimmune diseases, insulin resistance, psoriasis, rheumatoid arthritis, ankylosing spondylitis, tuberculosis, polycystic kidney disease, and cancer. Mutations affect susceptibility to cerebral malaria, septic shock, and Alzheimer’s disease. Mouse knockout studies suggest TNF also has neuroprotective functions.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out