LipoKnoxa™ Human ADRB3 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX430

Species: Human

Target Gene: ADRB3

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human ADRB3 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX430-1	TATCTCTGGTTCCCTTATTAC	3' UTR	Inquiry
V0126XX430-2	ACTGGCTAGGTTATGCCAATT	CDS	Inquiry
V0126XX430-3	CAGTGGCCTCTCTCACTTTAG	3' UTR	Inquiry
V0126XX430-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ADRB3 shRNA Lentiviral Particle (Silencing) targets the ADRB3, which is fundamental to catecholamine-induced lipolysis in adipose tissue. This lentiviral tool is developed using both U6 and miR30-based shRNA systems, providing researchers with flexible options for long-term silencing depth in primary adipocytes. Our particles are supported by comprehensive quality control documentation, confirming sequence accuracy and the total absence of pathogens.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ADRB3

Full Name: Adrenoceptor beta 3

Gene Symbol: BETA3AR

Gene ID: 155

RefSeq ID-1: NP_000016.1

RefSeq ID-2: NM_000025.3

Summary: The ADRB3 gene encodes the β-3 adrenergic receptor, a G protein-coupled receptor (GPCR) predominantly found on the surface of adipocytes (fat cells). This receptor acts as a primary transducer of catecholamine signals (like norepinephrine), initiating the downstream activation of adenylate cyclase. Physiologically, ADRB3 stimulation drives two critical energy-expending processes: lipolysis (breaking down stored fat) and thermogenesis (heat production). Polymorphisms within ADRB3 are frequently analyzed in human studies due to their correlation with individual variability in obesity susceptibility and overall metabolic rate.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out