LipoKnoxa™ Human RBP4 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX475-1	CTCAGTCTTCAGCTCTATTTA	3' UTR	Inquiry
V0126XX475-2	AGAAGCGCAGAAGATTGTAAG	CDS	Inquiry
V0126XX475-3	CAATATCAAGAATCTAGTTTC	CDS	Inquiry
V0126XX475-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human RBP4 shRNA Lentiviral Particle (Silencing) targets RBP4, an adipokine that induces insulin resistance in metabolic tissues. By utilizing high-potency U6-driven shRNA and physiologically optimized miR30 architectures, researchers can study the impact of RBP4 on glucose intolerance. To ensure experimental success, all particles undergo comprehensive quality control, covering functional titer, sequence integrity, and mycoplasma testing.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: RBP4

Full Name: Retinol binding protein 4

Gene Symbol: RDCCAS; MCOPCB10

Gene ID: 5950

RefSeq ID-1: NP_001310446.1

RefSeq ID-2: NM_001323517.1

Summary: RBP4 belongs to the lipocalin family and serves as the specific carrier protein for retinol (Vitamin A alcohol) in the bloodstream. Its primary function is to transport retinol from the liver storage sites to various peripheral tissues throughout the body. In plasma, the RBP4-retinol complex associates with transthyretin, which is necessary to prevent the complex from being rapidly filtered out and lost via the kidney glomeruli. RBP4 levels have been strongly linked to insulin resistance and Type 2 diabetes, and elevated circulating RBP4 has been observed in individuals with obesity.

LipoKnoxa™ Human RBP4 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products