Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human RBP4 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX475
Species: Human
Target Gene: RBP4
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human RBP4 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX475-1 CTCAGTCTTCAGCTCTATTTA 3' UTR Inquiry
V0126XX475-2 AGAAGCGCAGAAGATTGTAAG CDS Inquiry
V0126XX475-3 CAATATCAAGAATCTAGTTTC CDS Inquiry
V0126XX475-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human RBP4 shRNA Lentiviral Particle (Silencing) targets RBP4, an adipokine that induces insulin resistance in metabolic tissues. By utilizing high-potency U6-driven shRNA and physiologically optimized miR30 architectures, researchers can study the impact of RBP4 on glucose intolerance. To ensure experimental success, all particles undergo comprehensive quality control, covering functional titer, sequence integrity, and mycoplasma testing.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: RBP4
Full Name: Retinol binding protein 4
Gene Symbol: RDCCAS; MCOPCB10
Gene ID: 5950
RefSeq ID-1: NP_001310446.1
RefSeq ID-2: NM_001323517.1
Summary: RBP4 belongs to the lipocalin family and serves as the specific carrier protein for retinol (Vitamin A alcohol) in the bloodstream. Its primary function is to transport retinol from the liver storage sites to various peripheral tissues throughout the body. In plasma, the RBP4-retinol complex associates with transthyretin, which is necessary to prevent the complex from being rapidly filtered out and lost via the kidney glomeruli. RBP4 levels have been strongly linked to insulin resistance and Type 2 diabetes, and elevated circulating RBP4 has been observed in individuals with obesity.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.