Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human CEBPA shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX572
Species: Human
Target Gene: CEBPA
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human CEBPA shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX572-1 CCCGGCAACTCTAGTATTTAG 3' UTR Inquiry
V0126XX572-2 GCAAATCGTGCCTTGTCATTT 3' UTR Inquiry
V0126XX572-3 GCAACTCTAGTATTTAGGATA 3' UTR Inquiry
V0126XX572-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human CEBPA shRNA Lentiviral Particle (Silencing) facilitates the persistent knockdown of CEBPA, a master transcription factor governing adipocyte differentiation and lipid accumulation. Our lentiviral system supports flexible reporter gene inclusion and features dual expression strategies—the high-efficiency U6 system and the cell-type-specific miR30-based framework—to accommodate complex differentiation protocols. By specifically reducing CEBPA levels, this tool allows for the in-depth exploration of adipogenesis and its contribution to fat mass expansion. All preparations undergo comprehensive quality control screening for sequence integrity and microbial contaminants to guarantee reliable in vitro and ex vivo applications.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CEBPA
Full Name: CCAAT enhancer binding protein alpha
Gene Symbol: CEBP; C/EBP-alpha
Gene ID: 1050
RefSeq ID-1: NP_001272758.1
RefSeq ID-2: NM_001285829.2
Summary: CEBPA encodes a transcription factor with a basic leucine zipper (bZIP) domain that binds CCAAT motifs in target gene promoters. It forms homo- and heterodimers with CEBP family members, regulating genes involved in cell cycle control, adipocyte differentiation, and energy homeostasis. Disruptions in CEBPA activity may impact body weight regulation. Isoforms are generated from alternative start codons.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.