LipoKnoxa™ Human GFRAL shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX602-1	ATAACGTGAAAGAGGATAAAT	CDS	Inquiry
V0126XX602-2	CAATGCTTACGTGATGCAAAT	CDS	Inquiry
V0126XX602-3	CGTTCCCATCATGGATTCAAA	CDS	Inquiry
V0126XX602-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human GFRAL shRNA Lentiviral Particle (Silencing) focuses on the persistent knockdown of the GDF15 receptor, essential for mediating weight-reducing stress signals in the brainstem. By utilizing optimized U6 and miR30-based shRNA systems, this product enables the study of neural appetite regulation. Each viral batch is verified through total QC validation, including high-precision titering and sterility testing, ensuring data accuracy and biosafety for both neuronal and engineered cell models.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: GFRAL

Full Name: GDNF family receptor alpha like

Gene Symbol: GRAL; UNQ9356; C6orf144; bA360D14.1

Gene ID: 389400

RefSeq ID-1: NP_997293.2

RefSeq ID-2: NM_207410.2

Summary: GFRAL is a highly specialized receptor found in the hindbrain that serves as the exclusive landing site for the hormone GDF15. When GDF15 binds to GFRAL, it triggers a signaling cascade that potently suppresses appetite and induces weight loss. This makes GFRAL a cornerstone of the body’s "emergency" system for reducing food intake during stress or illness.

LipoKnoxa™ Human GFRAL shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products