LipoKnoxa™ Human STEAP4 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX591-1	GTGATTCCTATTCGATATTAT	CDS	Inquiry
V0126XX591-2	GCAGGTGTTTGTGTGTGGAAA	CDS	Inquiry
V0126XX591-3	CCAAGCAAAGAGTGATGGATA	CDS	Inquiry
V0126XX591-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human STEAP4 shRNA Lentiviral Particle (Silencing) targets a metalloreductase that modulates adipocyte inflammatory signaling and glucose metabolism. Engineered via our dual-strategy platform (U6 and miR30 systems), this lentiviral tool enables the stable dissection of cellular responses to obesity-linked cytokines. Every batch is subjected to total quality control, including functional titer, sterility, and mycoplasma testing, ensuring that your experimental results are scientifically sound and highly reproducible for both dividing and non-dividing cells.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: STEAP4

Full Name: STEAP4 metalloreductase

Gene Symbol: TIARP; STAMP2; SchLAH; TNFAIP9

Gene ID: 79689

RefSeq ID-1: NP_001192244.1

RefSeq ID-2: NM_001205315.2

Summary: STEAP4 encodes a Golgi-localized metalloreductase that plays a vital role in cellular mineral balance by reducing ferric iron and cupric copper. Beyond its enzymatic function, it is a key participant in adipocyte metabolism and development. By managing metal ion states, STEAP4 influences the oxidative environment of fat cells and is implicated in both normal prostate biology and the progression of certain cancers.

LipoKnoxa™ Human STEAP4 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products