Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human ENPP1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX431
Species: Human
Target Gene: ENPP1
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human ENPP1 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX431-1 CATGGGTTGAAGAATTGTTAA CDS Inquiry
V0126XX431-2 TGAGGGACGATCTTTGAATAT 3' UTR Inquiry
V0126XX431-3 GCTCATGTAACCCTTCGATTT CDS Inquiry
V0126XX431-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human ENPP1 shRNA Lentiviral Particle (Silencing) is designed to suppress the ENPP1 gene, which is implicated in insulin receptor inhibition and glucose intolerance. Utilizing an advanced RNAi platform with optimized U6 or miR30-based shRNA delivery, this tool assists in uncovering the pathways of insulin resistance. Every viral preparation is backed by exhaustive QC validation, including high-precision titering, sterility, and mycoplasma testing, ensuring optimal reliability.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ENPP1
Full Name: Ectonucleotide pyrophosphatase/phosphodiesterase 1
Gene Symbol: M6S1; NPP1; NPPS; PC-1; PCA1; ARHR2; COLED; PDNP1
Gene ID: 5167
RefSeq ID-1: NP_006199.2
RefSeq ID-2: NM_006208.3
Summary: ENPP1 belongs to a family of ecto-nucleotide enzymes that function as a dimeric transmembrane glycoprotein. This protein exhibits broad hydrolytic activity, cleaving phosphodiester and pyrophosphate bonds in various nucleotides and nucleotide sugars. It effectively dismantles compounds like nucleoside 5' triphosphates into monophosphates. Functionally, ENPP1 is a key player in regulating extracellular signaling and is highly significant in disease: genetic variants are strongly linked to insulin resistance, idiopathic infantile arterial calcification, and the spinal condition ossification of the posterior longitudinal ligament (OPLL).
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.