LipoKnoxa™ Human ENPP1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX431

Species: Human

Target Gene: ENPP1

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human ENPP1 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX431-1	CATGGGTTGAAGAATTGTTAA	CDS	Inquiry
V0126XX431-2	TGAGGGACGATCTTTGAATAT	3' UTR	Inquiry
V0126XX431-3	GCTCATGTAACCCTTCGATTT	CDS	Inquiry
V0126XX431-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ENPP1 shRNA Lentiviral Particle (Silencing) is designed to suppress the ENPP1 gene, which is implicated in insulin receptor inhibition and glucose intolerance. Utilizing an advanced RNAi platform with optimized U6 or miR30-based shRNA delivery, this tool assists in uncovering the pathways of insulin resistance. Every viral preparation is backed by exhaustive QC validation, including high-precision titering, sterility, and mycoplasma testing, ensuring optimal reliability.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ENPP1

Full Name: Ectonucleotide pyrophosphatase/phosphodiesterase 1

Gene Symbol: M6S1; NPP1; NPPS; PC-1; PCA1; ARHR2; COLED; PDNP1

Gene ID: 5167

RefSeq ID-1: NP_006199.2

RefSeq ID-2: NM_006208.3

Summary: ENPP1 belongs to a family of ecto-nucleotide enzymes that function as a dimeric transmembrane glycoprotein. This protein exhibits broad hydrolytic activity, cleaving phosphodiester and pyrophosphate bonds in various nucleotides and nucleotide sugars. It effectively dismantles compounds like nucleoside 5' triphosphates into monophosphates. Functionally, ENPP1 is a key player in regulating extracellular signaling and is highly significant in disease: genetic variants are strongly linked to insulin resistance, idiopathic infantile arterial calcification, and the spinal condition ossification of the posterior longitudinal ligament (OPLL).

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out