Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human KSR2 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX494
Species: Human
Target Gene: KSR2
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human KSR2 shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX494-1 CCAACCAGCAGAGGCAATAAT CDS Inquiry
V0126XX494-2 CAGCCAGGGTGATGCGTTATT 3' UTR Inquiry
V0126XX494-3 TGTGCGAGACTGTGGAGAAAT CDS Inquiry
V0126XX494-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human KSR2 shRNA Lentiviral Particle (Silencing) facilitates the stable knockdown of KSR2, a scaffold protein that regulates AMPK signaling and basal metabolic rate. Our lentiviral particles support dual expression strategies—U6 for high-potency silencing and miR30 for natural-mimicking processing—to meet diverse experimental needs. Rigorous quality control, including high-precision functional titering and mycoplasma detection, is performed on all particles to guarantee data safety.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: KSR2
Full Name: Kinase suppressor of ras 2
Gene ID: 283455
RefSeq ID-1: NP_775869.3
RefSeq ID-2: NM_173598.4
Summary: KSR2 encodes a serine/threonine kinase scaffold protein involved in Ras-mediated signaling, calcium-dependent pathways, and regulation of cold-induced thermogenesis. It functions upstream of the MAPK cascade and is localized in the cytosol and plasma membrane. Variants in KSR2 can disrupt energy balance and thermogenic responses, contributing to obesity.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.