LipoKnoxa™ Human MC5R shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX600-1	TCTTCCTTCATCTCACTTTAA	CDS	Inquiry
V0126XX600-2	TTGTGCGCCACATTGACAATG	CDS	Inquiry
V0126XX600-3	GCATTGCTGTGGAGGTGTTTC	CDS	Inquiry
V0126XX600-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human MC5R shRNA Lentiviral Particle (Silencing) is engineered to silence the MC5R, involved in exocrine function and energy balance. Our system provides two distinct expression strategies: high-potency U6 systems and physiologically refined miR30-based shRNA to explore the peripheral roles of melanocortins. To ensure the highest level of data reliability, every preparation undergoes total QC verification—including functional titer, sequence identity, and the absence of pathogens.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: MC5R

Full Name: Melanocortin 5 receptor

Gene Symbol: MC2

Gene ID: 4161

RefSeq ID-1: NP_005904.1

RefSeq ID-2: NM_005913.3

Summary: MC5R belongs to the melanocortin receptor family and is a G-protein-coupled receptor that triggers cAMP signaling. While it is highly recognized for its role in regulating sebum production in the skin, its broader physiological impact includes the coordination of specific metabolic responses to melanocyte-stimulating hormone and ACTH.

LipoKnoxa™ Human MC5R shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products