LipoKnoxa™ Human NHLH2 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX584-1	CAGAGTATGCAGGCTCATAAC	3' UTR	Inquiry
V0126XX584-2	CGTGTGATGAATTTAGCAAAT	3' UTR	Inquiry
V0126XX584-3	ACTTTGAGTTCTCCTACATTC	3' UTR	Inquiry
V0126XX584-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human NHLH2 shRNA Lentiviral Particle (Silencing) facilitates the stable knockdown of NHLH2, which is vital for the regulation of physical activity and energy expenditure. By utilizing specialized U6 or miR30-based shRNA delivery, this product assists in uncovering the hypothalamic control of weight management. Each batch is subjected to rigorous quality control validation, including functional titer and sterility testing, ensuring the repeatability of results and the safety of long-term gene modulation in neuronal or endocrine models.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: NHLH2

Full Name: Nescient helix-loop-helix 2

Gene Symbol: HEN2; HH27; NSCL2; bHLHa34

Gene ID: 4808

RefSeq ID-1: NP_001104531.1

RefSeq ID-2: NM_001111061.2

Summary: NHLH2 encodes a transcription factor expressed in the hypothalamus and peripheral nervous system, regulating energy balance and gonadotropin-releasing hormone neurons. It modulates appetite, metabolic rate, and adiposity, with mutations implicated in hypogonadotropic hypogonadism and obesity susceptibility.

LipoKnoxa™ Human NHLH2 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products