LipoKnoxa™ Human SH2B1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX446

Species: Human

Target Gene: SH2B1

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human SH2B1 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX446-1	TGGAAGGTCCATCCGAGTATA	CDS	Inquiry
V0126XX446-2	GAAGTCGCCTGGAGTTCTTTG	CDS	Inquiry
V0126XX446-3	TGTTGTCCTTGTCAGCTATGT	CDS	Inquiry
V0126XX446-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human SH2B1 shRNA Lentiviral Particle (Silencing) targets an essential adaptor protein that facilitates insulin and leptin receptor signaling. By utilizing our dual-strategy platform (U6 and miR30 systems), researchers can explore the genetic basis of insulin resistance in stable cell lines. Every batch is verified through rigorous QC—covering functional titer, sequence identity, and sterility—to ensure optimal reliability for signaling studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: SH2B1

Full Name: SH2B adaptor protein 1

Gene Symbol: PSM; SH2B

Gene ID: 25970

RefSeq ID-1: NP_001139267.1

RefSeq ID-2: NM_001145795.2

Summary: SH2B1 encodes a member of the SH2-domain-containing family of adaptor proteins. Its function is to mediate and integrate signals originating from various cytokine and growth factor receptors, including the leptin and insulin receptors. By binding to and modulating the activity of several crucial kinases (like JAK and IRS), SH2B1 plays a key role in cellular transformation and the signaling pathways governing metabolism and growth. Genetic variation in SH2B1 is strongly linked to obesity, severe insulin resistance, and hypertension, establishing it as a major hub connecting growth, signaling, and metabolic health.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out