LipoKnoxa™ Human BBS7 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX473

Species: Human

Target Gene: BBS7

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human BBS7 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX473-1	GCAGGAGAATGTGTGACATTT	CDS	Inquiry
V0126XX473-2	ATGAATCAGTTGACAACAAAT	3' UTR	Inquiry
V0126XX473-3	GAAATCGTGGTGTCCACATAT	CDS	Inquiry
V0126XX473-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human BBS7 shRNA Lentiviral Particle (Silencing) targets a vital component of the BBSome involved in the ciliary transport of G-protein coupled receptors. Engineered with both high-potency U6 and physiologically refined miR30-based shRNA, this tool helps researchers study energy homeostasis. Our particles are verified through rigorous QC—covering functional titer, sequence identity, and sterility—to ensure safety and high-fidelity signaling analysis.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: BBS7

Full Name: Bardet-Biedl syndrome 7

Gene Symbol: BBS2L1

Gene ID: 55212

RefSeq ID-1: NP_060660.2

RefSeq ID-2: NM_018190.3

Summary: BBS7 encodes one of the eight core subunits (BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9, and BBIP10) that form the crucial BBSome complex. The BBSome is a molecular coat complex believed to regulate the trafficking of signaling receptors to and from the primary cilium, promoting ciliogenesis. The assembly of this complex is mediated by the chaperonin-like BBS proteins (BBS6, BBS10, BBS12) and CCT/TRiC family chaperonins. Mutations in BBS7 are implicated in Bardet-Biedl syndrome (BBS), a disorder characterized by obesity, retinal degeneration, and nephropathy. However, mutations in BBS7 are generally considered to play a minor role compared to the chaperonin-like BBS genes, which are major contributors to disease development.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out