LipoKnoxa™ Human PLA2G5 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX583-1	ATCTGGTGTATGGGTATTAAA	3' UTR	Inquiry
V0126XX583-2	TACGCAAGAAGAGCCAAATTG	3' UTR	Inquiry
V0126XX583-3	TCGCACACAGTCCTACAAATA	CDS	Inquiry
V0126XX583-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PLA2G5 shRNA Lentiviral Particle (Silencing) targets PLA2G5, an enzyme involved in inflammatory responses and LDL modification. Our lentiviral particles are engineered using both high-potency U6-driven shRNA and physiologically refined miR30-based systems, enabling researchers to explore the impact of lipid-derived inflammatory mediators in metabolic disease. To ensure the highest level of biosafety, all products undergo total quality control screening, ensuring high functional titers and the absence of microbial contaminants for reliable ex vivo studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PLA2G5

Full Name: Phospholipase A2 group V

Gene Symbol: FRFB; GV-PLA2; PLA2-10; hVPLA(2)

Gene ID: 5322

RefSeq ID-1: NP_000920.1

RefSeq ID-2: NM_000929.3

Summary: PLA2G5 encodes a secretory phospholipase A2 that hydrolyzes phospholipids to release arachidonic acid and lysophospholipids. These lipid mediators regulate inflammation and adipose tissue remodeling, linking PLA2G5 activity to obesity and metabolic inflammation. Alternative splicing produces multiple variants.

LipoKnoxa™ Human PLA2G5 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products