LipoKnoxa™ Human ACACA shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX516-1	GTATGTTCGAAGGGCTTATAT	CDS	Inquiry
V0126XX516-2	GAATCCTCATTGGCCTATAAT	CDS	Inquiry
V0126XX516-3	TACAAGGGATACAGGTATTTA	CDS	Inquiry
V0126XX516-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ACACA shRNA Lentiviral Particle (Silencing) targets ACACA, the rate-limiting enzyme in fatty acid synthesis. Our lentiviral particles support dual expression strategies—U6 for high-potency silencing and miR30 for natural-mimicking processing. Each viral preparation is backed by exhaustive QC validation, including high-precision titering and sequence integrity.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ACACA

Full Name: Acetyl-CoA carboxylase alpha

Gene Symbol: ACC; ACAC; ACC1; ACCA; Acac1; hACC1; ACACAD; ACCalpha; ACACalpha

Gene ID: 31

RefSeq ID-1: NP_942131.1

RefSeq ID-2: NM_198834.3

Summary: ACACA encodes a multifunctional biotin-containing enzyme that catalyzes the rate-limiting step in fatty acid synthesis: the conversion of acetyl-CoA to malonyl-CoA. Highly enriched in adipose and hepatic tissues, the enzyme is under rigorous hormonal and allosteric control. Its activity levels directly determine the flux of carbon into lipid storage, making it a central node in the regulation of body fat accumulation.

LipoKnoxa™ Human ACACA shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products