LipoKnoxa™ Human RETN shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX444-1	TTAGGGCAATAAGCAGCATTG	CDS	Inquiry
V0126XX444-2	CTCCATGGAAGAAGCCATCAA	CDS	Inquiry
V0126XX444-3	ACCCTGTGCTCCATGGAAGAA	CDS	Inquiry
V0126XX444-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human RETN shRNA Lentiviral Particle (Silencing) targets Resistin, an adipokine linked to insulin resistance and inflammation. Our RNAi platform develops this product using both U6-driven shRNA for maximal knockdown and miR30-based systems for regulated expression in adipocyte models. Every batch is validated through total quality control, including high-precision titering and sterility testing, ensuring data reproducibility and safety.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: RETN

Full Name: Resistin

Gene Symbol: ADSF; RENT; RSTN; XCP1; FIZZ3; RETN1

Gene ID: 56729

RefSeq ID-1: NP_001180303.1

RefSeq ID-2: NM_001193374.2

Summary: RETN encodes a protein belonging to the resistin-like family, characterized by a unique C-terminal sequence featuring ten conserved cysteine residues. In rodents, the RETN homolog is an adipocyte-secreted hormone proposed to be a critical link between obesity and Type II diabetes by interfering with insulin signaling. In humans, its role is more complex, though it also displays an important antimicrobial function in the skin, actively defending against both Gram-positive and Gram-negative bacteria. Its dual function underscores its involvement in both metabolic balance and innate immunity.

LipoKnoxa™ Human RETN shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products