LipoKnoxa™ Human PNLIP shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX481-1	TTGCGGCCTGTAATCACTTAA	CDS	Inquiry
V0126XX481-2	CACCCGCTTCCTCCTATATAC	CDS	Inquiry
V0126XX481-3	AGTCGTGGGCCACCTAGATTT	CDS	Inquiry
V0126XX481-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PNLIP shRNA Lentiviral Particle (Silencing) targets PNLIP, the primary enzyme responsible for dietary fat digestion. By utilizing both U6 and miR30-based shRNA systems, researchers can evaluate the impact of reduced lipid absorption in stable cell models. To ensure the highest level of biosafety, all products undergo total quality control screening, ensuring high functional titers and the absence of pathogens.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: PNLIP

Full Name: Pancreatic lipase

Gene Symbol: PL; PTL; PNLIPD

Gene ID: 5406

RefSeq ID-1: NP_000927.1

RefSeq ID-2: NM_000936.4

Summary: PNLIP encodes a pancreatic lipase enzyme that is secreted into the small intestine, where it catalyzes the breakdown of dietary triglycerides. This enzyme is essential for the efficient digestion and absorption of fats. Inhibition of PNLIP activity has been shown to reduce obesity induced by high-fat diets in mice and can promote weight loss in humans with obesity. Mutations in this gene cause congenital pancreatic lipase deficiency, a rare disorder characterized by fat malabsorption and steatorrhea.

LipoKnoxa™ Human PNLIP shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products