LipoKnoxa™ Human THBS1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX573

Species: Human

Target Gene: THBS1

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human THBS1 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX573-1	AGACATCTTCCAAGCATATAA	3' UTR	Inquiry
V0126XX573-2	GTAGGTTATGATGAGTTTAAT	CDS	Inquiry
V0126XX573-3	CGTGACTGTAAGATTGTAAAT	3' UTR	Inquiry
V0126XX573-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human THBS1 shRNA Lentiviral Particle (Silencing) is developed for the targeted inhibition of thrombospondin 1, a glycoprotein significantly implicated in adipose tissue inflammation and insulin resistance. Our RNAi platform offers versatility through the development of both U6 and miR30-based shRNA systems, allowing for potent silencing in both dividing and non-dividing cells such as primary adipocytes. This tool is essential for uncovering the mechanisms of obesity-linked metabolic dysfunction. To ensure scientific robustness, each viral preparation is validated through rigorous quality control, covering functional titer, sterility, and mycoplasma testing, ensuring maximum safety and reproducibility.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: THBS1

Full Name: Thrombospondin 1

Gene Symbol: TSP; THBS; TSP1; TSP-1; THBS-1

Gene ID: 7057

RefSeq ID-1: NP_003237.2

RefSeq ID-2: NM_003246.3

Summary: THBS1 encodes a homotrimeric adhesive glycoprotein that interacts with fibrinogen, fibronectin, laminin, collagen, and integrins. Beyond its roles in angiogenesis and platelet function, THBS1 modulates extracellular matrix remodeling and inflammation, processes that influence adipose tissue expansion and metabolic dysfunction associated with obesity.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out