LipoKnoxa™ Human CNR1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX485-1	TGCTAATGTTTCCATAGTTTA	3' UTR	Inquiry
V0126XX485-2	TGCTTCTGTTCATCGTGTATG	CDS	Inquiry
V0126XX485-3	AGCTCATTAAGACGGTGTTTG	CDS	Inquiry
V0126XX485-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CNR1 shRNA Lentiviral Particle (Silencing) targets the CNR1, a key player in appetite and peripheral metabolism. Our lentiviral system supports both U6 and miR30-based shRNA strategies, offering researchers the choice between maximum potency and physiologically refined silencing. Every batch is validated through total QC validation, including sequence accuracy and functional titering, ensuring high biosafety for metabolic studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CNR1

Full Name: Cannabinoid receptor 1

Gene Symbol: CB1; CNR; CB-R; CB1A; CB1R; CANN6; CB1K5

Gene ID: 1268

RefSeq ID-1: NP_001153698.1

RefSeq ID-2: NM_001160226.3

Summary: CNR1 encodes cannabinoid receptor 1 (CB1), a G protein–coupled receptor that mediates the effects of cannabinoids, including Δ9-tetrahydrocannabinol. CB1 signaling inhibits adenylate cyclase, regulates neuronal activity, and modulates appetite and energy balance. Through its central nervous system functions, CNR1 contributes to feeding behavior and body weight regulation. Multiple transcript variants give rise to two distinct protein isoforms.

LipoKnoxa™ Human CNR1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products