LipoKnoxa™ Human UCP1 shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX442

Species: Human

Target Gene: UCP1

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human UCP1 shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX442-1	TGTACAGAGCTAGTAACATAT	CDS	Inquiry
V0126XX442-2	ACTATGGACTGTGCCACATAA	CDS	Inquiry
V0126XX442-3	CGTCCAGTGTTATTAGGTATA	CDS	Inquiry
V0126XX442-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human UCP1 shRNA Lentiviral Particle (Silencing) targets the hallmark thermogenic protein of brown adipose tissue, UCP1. By utilizing a choice between high-potency U6 systems and physiologically refined miR30-based shRNA, researchers can investigate the impact of thermogenic failure on energy expenditure in brown or beige adipocytes. Every preparation undergoes total QC verification—covering sequence identity and functional activity—to ensure that your experimental results are scientifically sound.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: UCP1

Full Name: Uncoupling protein 1

Gene Symbol: UCP; SLC25A7

Gene ID: 7350

RefSeq ID-1: NP_068605.1

RefSeq ID-2: NM_021833.5

Summary: UCP1 is the prototypical member of the mitochondrial uncoupling protein family, embedded in the inner mitochondrial membrane. Its function is unique and specialized: it mediates the "mitochondrial proton leak," a process that uncouples oxidative phosphorylation from ATP synthesis, allowing the potential energy of the proton gradient to be rapidly dissipated solely as heat. UCP1 expression is strictly restricted to brown adipose tissue (BAT), the specialized fat tissue dedicated to nonshivering thermogenesis. This protein is critical for regulating body temperature and is highly studied for its potential role in combating obesity by increasing energy expenditure.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out