LipoKnoxa™ Human FTO shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX422

Species: Human

Target Gene: FTO

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human FTO shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX422-1	CCCATTAGGTGCCCATATTTA	3' UTR	Inquiry
V0126XX422-2	GCCAGTGAAAGGGTCTAATAT	CDS	Inquiry
V0126XX422-3	TCGCATGGCAGCAAGCTAAAT	3' UTR	Inquiry
V0126XX422-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human FTO shRNA Lentiviral Particle (Silencing) is specifically designed to achieve stable and efficient suppression of the FTO gene, the primary genetic risk factor for common obesity. Utilizing advanced RNAi architectures, including high-potency U6-driven or physiologically refined miR30-based shRNA systems, this product enables the investigation of m6A demethylation and its role in cellular energy metabolism. Each batch is subjected to total quality control screening for functional titer, sterility, and mycoplasma, ensuring the highest level of biosafety and experimental reproducibility for your long-term cell line studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: FTO

Full Name: Alpha-ketoglutarate-dependent dioxygenase

Gene Symbol: GDFD; IFEX9; ALKBH9; BMIQ14

Gene ID: 79068

RefSeq ID-1: NP_001073901.1

RefSeq ID-2: NM_001080432.3

Summary: The FTO gene encodes a nuclear protein dioxygenase belonging to the AlkB family. Its core biochemical function involves participating in the oxidative demethylation of nucleic acids (DNA/RNA), considered a DNA repair mechanism. Functional studies have established FTO as one of the most significant genetic factors influencing BMI and obesity risk. Extensive data indicate that FTO functional defects are not only associated with type 2 diabetes but also play a substantial role in the nervous and cardiovascular systems, making it a focal point in research on genetic susceptibility to metabolic diseases.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out