LipoKnoxa™ Human MC4R shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX423

Species: Human

Target Gene: MC4R

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human MC4R shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX423-1	CCATTGTCATCACCCTATTAA	CDS	Inquiry
V0126XX423-2	CCCATTCTTCCTCCACTTAAT	CDS	Inquiry
V0126XX423-3	AGCGGGTTGGGATCATCATAA	CDS	Inquiry
V0126XX423-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human MC4R shRNA Lentiviral Particle (Silencing) facilitates the persistent knockdown of the MC4R, a master gatekeeper of hunger and satiety. To provide researchers with maximal flexibility, we offer shRNA development through both U6 and miR30-based expression frameworks, allowing for the dissection of G-protein coupled receptor signaling in neural or engineered cell models. Our lentiviral particles undergo rigorous quality control, including high-precision titering and sequence integrity verification, ensuring reliable and safe results for metabolic signaling research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: MC4R

Full Name: Melanocortin receptor 4

Gene Symbol: BMIQ20

Gene ID: 4160

RefSeq ID-1: NP_005903.2

RefSeq ID-2: NM_005912.3

Summary: The protein encoded by the MC4R gene is a G protein-coupled receptor (GPCR) located on the cell membrane, serving as a core component of the central appetite regulation circuit. It plays a crucial role in balancing energy intake by mediating interactions with ligands such as adrenocorticotropic hormone (ACTH) and melanocyte-stimulating hormone (MSH). Functional defects in MC4R constitute the most common monogenic cause of obesity, leading to autosomal dominant obesity. This gene lacks introns, underscoring its direct and critical role in neuroendocrine signaling.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out