LipoKnoxa™ Human IKBKB shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX597-1	CAAGGAGAACAGAGGTTAATA	CDS	Inquiry
V0126XX597-2	GTATTTCAGACGGCAAGTTAA	CDS	Inquiry
V0126XX597-3	GGCAGTCTTTGCACATCATTC	CDS	Inquiry
V0126XX597-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human IKBKB shRNA Lentiviral Particle (Silencing) targets IKK-beta, the fundamental kinase linking obesity-induced inflammation to systemic insulin resistance. Engineered with both U6 and miR30-based shRNA architectures, this tool allows for the investigation of NF-κB-mediated metabolic dysfunction. Rigorous quality control, including high-precision functional titering and microbial contaminants screening, is conducted on every batch to guarantee the highest level of biosafety and experimental reliability.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: IKBKB

Full Name: Inhibitor of nuclear factor kappa B kinase subunit beta

Gene Symbol: IKK2; IKKB; IKK-2; IMD15; IMD15A; IMD15B; NFKBIKB; IKK-beta

Gene ID: 3551

RefSeq ID-1: NP_001177649.1

RefSeq ID-2: NM_001190720.2

Summary: IKBKB acts as the primary ignition switch for the NF-kappa-B inflammatory pathway. By phosphorylating the inhibitor of NF-kappa-B, it triggers the release and activation of this master transcription factor. This gene is a critical link between high-calorie diets and the "meta-inflammation" that leads to insulin resistance and chronic metabolic disease.

LipoKnoxa™ Human IKBKB shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products