LipoKnoxa™ Human LPL shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX454-1	GCCTGAAGTTTCCACAAATAA	CDS	Inquiry
V0126XX454-2	TATTGGGCCATAGCCTATAAT	3' UTR	Inquiry
V0126XX454-3	CCATGACAAGTCTCTGAATAA	CDS	Inquiry
V0126XX454-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human LPL shRNA Lentiviral Particle (Silencing) is engineered for the robust suppression of LPL, the enzyme central to triglyceride hydrolysis and lipid partitioning. By offering high-potency U6 systems for maximal knockdown and miR30-based systems for physiologically optimized processing, this product allows for the investigation of hyperlipidemia in stable cell models. Every batch is validated through total QC processes, including high-precision titering and mycoplasma detection, ensuring excellent biosafety.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: LPL

Full Name: Lipoprotein lipase

Gene Symbol: LIPD; HDLCQ11

Gene ID: 4023

RefSeq ID-1: NP_000228.1

RefSeq ID-2: NM_000237.3

Summary: LPL encodes lipoprotein lipase, which is expressed in the heart, muscle, and adipose tissue. The protein functions as a homodimer, serving both as a triglyceride hydrolase and a ligand/bridging factor for receptor-mediated lipoprotein uptake. Severe mutations leading to LPL deficiency cause type I hyperlipoproteinemia, while milder mutations are associated with various disorders of lipid metabolism.

LipoKnoxa™ Human LPL shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products