LipoKnoxa™ Human BBS1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX460-1	GCCGCAATGGAAACATCTATA	CDS	Inquiry
V0126XX460-2	TGCCTAGCGCTGGCAGATTTA	CDS	Inquiry
V0126XX460-3	CCCAGGAAACTTCTCTGAAAT	3' UTR	Inquiry
V0126XX460-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human BBS1 shRNA Lentiviral Particle (Silencing) targets a core component of the BBSome, essential for ciliary protein trafficking and leptin signaling. Engineered via our dual-strategy platform (U6 and miR30 systems), this tool enables the stable modeling of Bardet-Biedl Syndrome in ciliated cell lines. We guarantee the quality of every batch through stringent QC verification, including sterility, mycoplasma testing, and sequence verification, ensuring high-fidelity results.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: BBS1

Full Name: Bardet-Biedl syndrome 1

Gene Symbol: BBS2L2

Gene ID: 582

RefSeq ID-1: NP_078925.3

RefSeq ID-2: NM_024649.4

Summary: Mutations in BBS1 are associated with Bardet-Biedl syndrome type 1. The protein encoded by this gene is implicated in the development of the eye, limb, cardiac, and reproductive systems.

LipoKnoxa™ Human BBS1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products