Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human NR0B2 shRNA Lentiviral Particle (Silencing)
Cat. No.:
V0126XX453
Species:
Human
Target Gene:
NR0B2
Vector System:
Lentiviral
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX453-1 | CTCTTCTTTCGCCCTATCATT | CDS | Inquiry |
| V0126XX453-2 | CCCAGCATACTCAAGAAGATT | CDS | Inquiry |
| V0126XX453-3 | CACATTGGACTTCCTTGGTTT | 3' UTR | Inquiry |
| V0126XX453-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human NR0B2 shRNA Lentiviral Particle (Silencing) provides an efficient solution for the long-term silencing of the SHP, a key nuclear receptor corepressor in bile acid and glucose homeostasis. Developed through an advanced RNAi platform with a choice of U6 or miR30-based systems, this tool enables in-depth metabolic pathway analysis. Our lentiviral particles support the flexible selection of reporter genes and undergo total quality control screening for functional titer and sterility to guarantee consistent results.
Production Cell Line:
HEK293T
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test:
Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test:
Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC:
Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage:
Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability:
Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition:
Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes:
Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.
Target Profile
Gene Name:
NR0B2
Full Name:
Nuclear receptor subfamily 0 group B member 2
Gene Symbol:
SHP; SHP1
Gene ID:
8431
RefSeq ID-1:
NP_068804.1
RefSeq ID-2:
NM_021969.3
Summary:
The protein encoded by NR0B2 is an atypical orphan nuclear receptor containing a putative ligand-binding domain but lacking a conventional DNA-binding domain. As a member of the nuclear hormone receptor family, it can interact with retinoid, thyroid, and estrogen receptors, repressing their ligand-dependent transcriptional activity through coactivator competition and direct transcriptional repression. Studies indicate that NR0B2 may influence metabolic regulation and energy homeostasis, and disruptions in its function have been linked to obesity, in addition to its roles in hormone signaling pathways.