LipoKnoxa™ Human ACOT11 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX620-1	TCTCGGCAAGTGGCTTCTATT	CDS	Inquiry
V0126XX620-2	ATCACCAGGGCAACACCTTTG	CDS	Inquiry
V0126XX620-3	CATCGTGAACAATGCCTTCAA	CDS	Inquiry
V0126XX620-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ACOT11 shRNA Lentiviral Particle (Silencing) targets ACOT11, a critical regulator of thermogenesis in brown fat and metabolic efficiency. Utilizing our advanced RNAi platform with a choice of U6 or miR30-based systems, researchers can evaluate the role of fatty acid flux in energy expenditure. Each batch undergoes comprehensive quality control screening for functional titer, sequence identity, and sterility, providing a secure and reliable tool for thermogenesis research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ACOT11

Full Name: Acyl-CoA thioesterase 11

Gene Symbol: BFIT; THEA; THEM1; STARD14

Gene ID: 26027

RefSeq ID-1: NP_056362.1

RefSeq ID-2: NM_015547.4

Summary: ACOT11 encodes an acyl-CoA thioesterase that hydrolyzes fatty acyl-CoA esters into free fatty acids and coenzyme A. In mouse models, ACOT11 expression in brown adipose tissue is induced by cold exposure and suppressed by warmth, indicating a role in thermogenesis. Notably, higher expression of ACOT11 has been observed in obesity-resistant mice compared with obesity-prone strains, suggesting a protective role against excessive fat accumulation. Alternative splicing generates multiple transcript variants.

LipoKnoxa™ Human ACOT11 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products