LipoKnoxa™ Human NCOA1 shRNA Lentiviral Particle (Silencing)

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX585-1	AGTTACGGCATGCTGATATAG	CDS	Inquiry
V0126XX585-2	TATGAATGAAGGACCCAATAA	CDS	Inquiry
V0126XX585-3	ACCGACAGAGGCAGCTAATAC	CDS	Inquiry
V0126XX585-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human NCOA1 shRNA Lentiviral Particle (Silencing) targets NCOA1, a protein that enhances the activity of various metabolic transcription factors. Engineered via our dual-strategy platform (U6 and miR30 systems), this lentiviral tool allows for the stable dissection of hormone-responsive energy regulation pathways. To guarantee experimental reliability, every preparation undergoes total QC verification—covering functional titer, sequence identity, and mycoplasma testing—providing a secure technical foundation for metabolic research.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: NCOA1

Full Name: Nuclear receptor coactivator 1

Gene Symbol: SRC1; KAT13A; RIP160; F-SRC-1; bHLHe42; bHLHe74

Gene ID: 8648

RefSeq ID-1: NP_001349879.1

RefSeq ID-2: NM_001362950.1

Summary: NCOA1 encodes a transcriptional coactivator for steroid and nuclear hormone receptors. By enhancing transcription of genes regulating adipocyte function, lipid metabolism, and insulin sensitivity, NCOA1 plays a role in obesity risk. Alternative splicing generates isoforms with distinct regulatory capacities.

LipoKnoxa™ Human NCOA1 shRNA Lentiviral Particle (Silencing)

Product Overview

Specification

Target Profile

Related Products