LipoKnoxa™ Human CARTPT shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX471

Species: Human

Target Gene: CARTPT

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human CARTPT shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX471-1	TTGATACGTGTGTGAAGTATT	3' UTR	Inquiry
V0126XX471-2	TTGGCTTAAGCAACAGATAAA	3' UTR	Inquiry
V0126XX471-3	CCTTCCTCCTGAAGTGCTTAT	CDS	Inquiry
V0126XX471-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human CARTPT shRNA Lentiviral Particle (Silencing) provides an efficient system for silencing the CART neuropeptide, a central regulator of feeding behavior and energy expenditure. Our platform utilizes both U6-driven and miR30-based shRNA systems to accommodate various experimental silencing needs. Supported by total quality control screening, these particles guarantee high purity and stable integration for in-depth neuro-metabolic studies.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CARTPT

Full Name: CART prepropeptide

Gene Symbol: CART

Gene ID: 9607

RefSeq ID-1: NP_004282.1

RefSeq ID-2: NM_004291.4

Summary: CARTPT encodes a precursor protein that undergoes proteolytic processing to yield several biologically active peptides, collectively known as CART peptides. These peptides are essential modulators in the central nervous system, playing a critical role in appetite regulation, energy balance, the maintenance of body weight, reward, addiction, and the stress response. Its role was first highlighted in rodents, where its transcript expression was upregulated following cocaine and amphetamine administration. Due to its central influence over satiety and energy expenditure, mutations in CARTPT are associated with susceptibility to obesity in humans.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out