Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human CARTPT shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX471
Species: Human
Target Gene: CARTPT
Vector System: Lentiviral
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human CARTPT shRNA Lentiviral Particle (Silencing)
SPECIFIC INQUIRY
Mammalian Cell Selection:
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX471-1 TTGATACGTGTGTGAAGTATT 3' UTR Inquiry
V0126XX471-2 TTGGCTTAAGCAACAGATAAA 3' UTR Inquiry
V0126XX471-3 CCTTCCTCCTGAAGTGCTTAT CDS Inquiry
V0126XX471-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human CARTPT shRNA Lentiviral Particle (Silencing) provides an efficient system for silencing the CART neuropeptide, a central regulator of feeding behavior and energy expenditure. Our platform utilizes both U6-driven and miR30-based shRNA systems to accommodate various experimental silencing needs. Supported by total quality control screening, these particles guarantee high purity and stable integration for in-depth neuro-metabolic studies.
Production Cell Line: HEK293T
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.
Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.
Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.
Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.
Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.
Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.
Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.
Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: CARTPT
Full Name: CART prepropeptide
Gene Symbol: CART
Gene ID: 9607
RefSeq ID-1: NP_004282.1
RefSeq ID-2: NM_004291.4
Summary: CARTPT encodes a precursor protein that undergoes proteolytic processing to yield several biologically active peptides, collectively known as CART peptides. These peptides are essential modulators in the central nervous system, playing a critical role in appetite regulation, energy balance, the maintenance of body weight, reward, addiction, and the stress response. Its role was first highlighted in rodents, where its transcript expression was upregulated following cocaine and amphetamine administration. Due to its central influence over satiety and energy expenditure, mutations in CARTPT are associated with susceptibility to obesity in humans.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.