LipoKnoxa™ Human ACLY shRNA Lentiviral Particle (Silencing)

Cat. No.: V0126XX612

Species: Human

Target Gene: ACLY

Vector System: Lentiviral

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human ACLY shRNA Lentiviral Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX612-1	GCCTCAAGATACTATACATTT	3' UTR	Inquiry
V0126XX612-2	CGTGAGAGCAATTCGAGATTA	CDS	Inquiry
V0126XX612-3	CCTATGACTATGCCAAGACTA	CDS	Inquiry
V0126XX612-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human ACLY shRNA Lentiviral Particle (Silencing) targets ACLY, the bridge between glucose metabolism and de novo fatty acid synthesis. Our lentiviral particles are engineered with both U6 and miR30-based shRNA frameworks to study the inhibition of lipid production in hepatic and adipocytes, etc. To ensure experimental success, all particles undergo comprehensive quality control, covering functional titer, sequence integrity, and sterility checks, ensuring consistent and reproducible data.

Production Cell Line: HEK293T

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: Comprehensive sequencing and PCR analyses were performed to verify the accurate genomic sequence of all viral preparations.

Sterility Test: Confirmed sterile via rigorous microbial analysis; free of bacterial and fungal contamination.

Mycoplasma Test: Rigorous quality control testing has confirmed the absence of mycoplasma contamination in this viral preparation.

Other QC: Customized supplementary testing and in vitro/in vivo assessments are available to verify post-silencing gene expression and biological functionality, ensuring the viral preparations meet the specific potency requirements of your gene interference project.

Storage: Store at -80°C for long-term preservation. Immediate transfer upon delivery is required to prevent loss of viral activity.

Stability: Shelf life: 6–12 months at -80°C (extended stability up to 2 years). Post-thaw: Stable at 4°C for 2–3 weeks without significant degradation of functional titers.

Shipping Condition: Products are delivered on dry ice to maintain the cold chain. Upon arrival, please ensure the presence of dry ice and transfer the vials immediately to -80°C storage.

Handling Notes: Avoid repeated freeze-thaw cycles. Aliquot into low-protein-binding tubes immediately after receipt to maintain optimal activity. For safety and contamination control, all viral handling must be performed inside a biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: We ensure product integrity through rigorous QC, but we do not guarantee results in specific research contexts. Proper storage, handling, and total compliance with biosafety laws and safety protocols remain the sole responsibility of the user.

Target Profile

Gene Name: ACLY

Full Name: ATP citrate lyase

Gene Symbol: ACL; ATPCL; CLATP

Gene ID: 47

RefSeq ID-1: NP_001087.2

RefSeq ID-2: NM_001096.2

Summary: ACLY encodes ATP citrate lyase, the principal enzyme responsible for generating cytosolic acetyl-CoA from citrate in many tissues. This tetrameric enzyme catalyzes the ATP-dependent conversion of citrate and CoA into acetyl-CoA and oxaloacetate. Acetyl-CoA produced by ACLY serves as a central metabolic intermediate for lipogenesis and cholesterogenesis, processes that are often upregulated in obesity. In adipose tissue and liver, increased ACLY activity supports fatty acid synthesis and lipid accumulation, thereby contributing to weight gain and metabolic dysfunction. In nervous tissue, ACLY may also participate in acetylcholine biosynthesis. Multiple transcript variants encoding distinct isoforms have been identified.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out